Posts

Human Variation & Race

Image
1.  Cold climates pose a threat to humans by presenting the possibility of frostbite among other survival risks. 2. Goosebumps that raise the hair on the skin in order to retain warmth are an example of a short-term adaptation to the cold. Gaining weight to stay warm is an example of a facultative adaptation. Facial hair is an example of a developmental adaptation to retain warmth. Clothing is an example of a cultural adaptation. 3. The benefit of studying human variation from this perspective gives an unbiased and scientific reasoning behind the traits that various humans around the world exhibit. These findings can help us better figure out the nature of human adaptation. This information could be used in developing products that can help to enhance or act in lieu of natural human adaptations. 4. Adaptations happen often within a population as a whole. This makes it easy to understand race and its geographical relationship. Understanding environmental influences
2 comments
Read more

Language Experiment

Part 1: Conversation for 15 minutes. Not allowed to use any version of a symbolic language (no speaking, writing, or ASL). - The experience of attempting to communicate without any words was very challenging. My partner was forced to guess what I was referring to rather than knowing what I wanted to do. I attempted to have them get me a few things from the kitchen like a glass of water and some snacks. It proved difficult getting my points across because even the nodding of my head would be a form of language derived from English. My partner had to continually guess what I was thinking until I finally was able to give an ambiguously affirming response to their guess.  - It seemed as if I was completely in control of the conversation considering that I wanted something out of it. It became a game of signaling and guessing where I was in control of what my partner reacted to. This being said, I had little power even though I held the attention. I imagine that if there were multiple peo
4 comments
Read more

The Piltdown Hoax

1. The Piltdown Hoax was a series of false archeological discoveries made by amateur archeologists the early 1900's near the town of Piltdown, England. These discoveries were alleged to be early humanoid skull pieces. The discovery would have taught the scientific community about the progression from ape to man. The main discovery would be the order in which humans developed; either big brain first, or upright walking first. It received wide press and praise from England and other archeologists. 2. The impulsiveness of scientists that are bound to their country was the main impact that affected the hoax's effectiveness. Scientists in England were too eager to take pride in early man being found in England to challenge the discovery. 3. Measuring the fluorine content of the bones was the technology that began to reveal that the discoveries were a hoax. Later, it was found that the bones were coated to appear older than they were. 4. No matter what, there would have to be
4 comments
Read more

Homology and Analogy

Image
1. a. Cats and humans are both mammals. Cats have evolved to be hunters in the wild while humans have evolved to be omnivorous and hyper intelligent. This being said, the common ancestor between humans and cats is closer than that of many other animals.  Among their similarities is the distinct bone structure of cat paws and human hands. b. They both have a joint structure and individual digits. The primary difference between them is that humans have thumbs, allowing them to grab onto things. Cats do not have this ability but they do have claws that help them hunt. These two species evolved separately from each other, developing traits that gave them distinct advantages in the wild. Cats became agile and stealthy while humans began to walk on two feet and make usable tools with their thumbs. c. The common ancestor between cats and humans was likely a small mammal with paw-like appendages. We know that this common ancestor had these is because humans and cats both have
4 comments
Read more

DNA Strand

GCTAATTACCACGGCTTGAACGCAAGCCCCAGTGGACTCATCCGCGCGCT
5 comments
Read more

Historical Influences on Charles Darwin

     Sir Charles Lyell was a geologist who theorized about changes to the earth's surface over long periods of time. He was the first to popularize the concept that geological phenomena happened as a result of natural progression rather than supernatural circumstances. His concepts suggested that the Earth was much older than perviously thought. https://www.britannica.com/biography/Sir-Charles-Lyell-Baronet      Charles Lyell's contributions are most visible in Darwin's idea that "Individuals do not evolve. Populations do." Lyell popularized the concept that the Earth changed slowly over extended periods of time. Darwin rejected the ideas of Lamarck who theorized that learned traits were passed on to further generations, rather attributing the change to genetic variations among species refined gradually over vast periods of time. Lyell laid the groundwork for these ideas.http://www.ucmp.berkeley.edu/history/lamarck.html         Charles Darwin could not have
3 comments
Read more